OP-SOLEXA-nanoCAGE-Direct-v1.4
From FANTOM5_SSTAR
Protocol: OP-SOLEXA-nanoCAGE-Direct-v1.4-step1
Author: Salimullah, Md.
Created: September 2, 2009
Update: July 8, 2010
Parameters: RNA-mass, RNA-volume, reverse-transcriptase, first-strand-quantity, RNA-cleaning-kit, second-strand-PCR-cycles, PCR-cleaning-kit, barcode_id [4], barcode_sequence
Description:
[RNA-mass] ng of total RNA ([RNA-volume] µl) were mixed with 1 µl of a solution of 0.66 M D-Trehalose, 3.3 M D-Sorbitol, 100 µM of template-switching oligonucleotide TS-oligonucleotide [1], 10 µM of reverse-transcription primer RT-primer [2]. The volume was reduced to 2 µl by centrifugal evaporation at room temperature. The mixture was then heat-denatured at 65°C for 10 min in a thermocycler and transferred quickly on an ice/water mixture.
First-strand synthesis and template-switching were accomplished together in a volume of 10.0 µl with the following components: 1× first strand buffer, 625 nM dNTPs, 10 mM DTT, 0.75 M betaine, and [reverse-transcriptase]. The reactions were incubated at 22°C for 10 min, 40°C for 30 min, 75°C for 15 min in a thermocycler, and then immediately transferred on an ice/water mix. First strand cDNAs were cleaned using [RNA-cleaning-kit].
For second-strand synthesis, first strand cDNAs were amplified in two PCRs of 100 µl using a mixture containing [first-strand-quantity] µl of templates, 1x ExTaq Buffer, 200 µM dNTPs, 100 nM forward PCR primer [3], 100 nM reverse PCR primer [3], and 2.5 U of ExTaq HS with the following thermocycling program: 1 min 95°C, [second-strand-PCR-cycles] x (15 s at 95°C, 10 s at 65°C, 2 min at 68°C). PCR products were cleaned using [PCR-cleaning-kit]. Concentrations of the purified PCR products were measured by NanoDrop, diluted all to 10 ng/µl and pooled.
References/Notes:
[1] The sequence of template-switching oligonucleotide is as follows.
TAGTCGAACTGAAGGTCTCCAGCA[barcode_sequence](rG)(rG)(rG)
[2] The sequence of reverse-transcription primer is as follows.
TAGTCGAACTGAAGGTCTCCGAACCGCTCTTCCGATCTN(6)
[3] The sequences of second strand PCR primers are as follows.
forward PCR primer (second-strand-PCR-forward):
TAGTCGAACTGAAGGTCTCCAGC
reverse PCR primer (second-strand-PCR-reverse):
TGACGTCGTCTAGTCGAACTGAAGGTCTCCGAACC
[4] The parameter [barcode_id] is an internal ID for [barcode_sequence].
Protocol: OP-SOLEXA-nanoCAGE-Direct-v1.4-step2
Author: Salimullah, Md.
Created: September 2, 2009
Update: July 8, 2010
Parameters: SOLEXA-PCR-cycles, PCR-cleaning-kit
Description:
Pooled PCR products were amplified by three PCR reactions of 100 µl with 200 nM of forward PCR primer [1], 200 nM of reverse PCR primer [1], 1x ExTaq buffer (TaKaRa), 200 µM dNTPs (TaKaRa), 2.5 U of ExTaq HS (TaKaRa) with the following program: 1 min 95°C, 1 x (15 s at 95°C, 10 s at 55°C, 2 min at 68°C), 6 x (15 s at 95°C, 10 s at 65°C, 2 min at 68°C). PCR products were cleaned using [PCR-cleaning-kit]. Concentrations of the purified libraries were measured by NanoDrop (Total) and Agilent Bioanalyzer (Fraction; 200-700 bp). Concentrations by Bioanalyzer were adjusted to ~15 pM (final sequencing concentration) and sequenced.
References/Notes:
[1] The sequences of PCR primers are as follows.
forward PCR primer (SOLEXA-PCR-forward):
AATGATACGGCGACCACCGAGATCTACACTAGTCGAACTGAAGG
reverse PCR primer (SOLEXA-PCR-reverse):
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
See also:
NanoCAGE: A High-Resolution Technique to Discover and Interrogate Cell Transcriptomes. Salimullah M, Mizuho S, Plessy C, Carninci P. Cold Spring Harb Protoc. 2011 Jan 1;2011:pdb.prot5559. doi: 10.1101/pdb.prot5559. http://pubmed.gov/21205859
Linking promoters to functional transcripts in small samples with nanoCAGE and CAGEscan. Plessy C, Bertin N, Takahashi H, Simone R, Salimullah M, Lassmann T, Vitezic M, Severin J, Olivarius S, Lazarevic D, Hornig N, Orlando V, Bell I, Gao H, Dumais J, Kapranov P, Wang H, Davis CA, Gingeras TR, Kawai J, Daub CO, Hayashizaki Y, Gustincich S, Carninci P. Nat Methods. 2010 Jul;7(7):528-34. Epub 2010 Jun 13. http://pubmed.gov/20543846
